 |
|
Annotator: Guillaume Luxardi 2007-01-19
Curator: Delphine Dauga 2010-03-01
Regulatory Region REG00000010: Otx -1541/-1417
Status: Curated
Natural Region from Ciona intestinalis
Position in the genome obtained: See it in GBrowse
Modification of Otx -1541/161 by deletion;
Comments:
This region, also called otx a-element, drives expression in the induced animal territories a6.5 and b6.5 at the late 32-cell stage.
Transcription start site is based on the start of the first exon of the JGI transcript model.
Hierarchy of Regulatory Regions:
REG00000007: Otx -3541/1333 [ Extended Promoter ]
| (deletion) REG00000008: Otx -3541/161 [ Extended Promoter ]
| | (deletion) REG00000242: Otx -2165/161 [ Extended Promoter ]
| | | (deletion) REG00000243: Otx -1723/161 [ Extended Promoter ]
| | | | (deletion) REG00000009: Otx -1541/161 [ Extended Promoter ]
| | | | | (deletion) Otx -1541/-1417 [ Enhancer ]
| | | | | | (mutation) REG00000013: Otx -1541/-1417 Ets1-2 mutated [ Enhancer ]
| | | | | | (mutation) REG00000012: Otx -1541/-1417 Ets1 mutated [ Enhancer ]
| | | | | | (mutation) REG00000011: Otx -1541/-1417 Ets2 mutated [ Enhancer ]
| | | | | | (mutation) REG00000015: Otx -1541/-1417 GATA1 mutated [ No Activity ]
| | | | | | (mutation) REG00000014: Otx -1541/-1417 GATA2-3 mutated [ Unknown Activity ]
| | | | | | (deletion) REG00000016: Otx -1472/-1417 [ Enhancer ]
| | | | | | | (deletion) REG00000248: Otx -1472/-1417 delta -1464/-1436 [ Enhancer ]
| | | | | | | | (artificial modification) REG00000439: Otx -1472/-1417 delta -1464/-1436 dimer [ Enhancer ]
| | | | | | | (deletion) REG00000246: Otx -1464/-1436 [ Enhancer ]
| | | | | (deletion) REG00000017: Otx -1417/161 [ Extended Promoter ]
| | | | | | (deletion) REG00000244: Otx -1133/161 [ Extended Promoter ]
| | | | | | | (deletion) REG00000018: Otx -706/161 [ Extended Promoter ]
| | | | | | | | (deletion) REG00000019: Otx -271/161 [ No Activity ]
| (deletion) REG00000245: Otx -271/1333 [ Extended Promoter ]
Type of Regulation: Enhancer
Regulated genes:
oc / OTX1 / OTX2 / CRX / Ci-otx / Otx (aniseedV3_3592)
Constructs made to test this region:
Construct CONS00000004: pOtx -1541/-1417 pBra::NLSLacZ (View Insitu Data)
Overview of the regulatory motifs in this sequence:
-1541
Regulatory motifs:
| Motif Name | Binding Factor(s) | Sequence | Position in Region | Comments | |
| 1 | GATA | ci0100131697 | TTATCT | [-1470 / -1465] | |
| 2 | Ets | ci0100140048 | CGGAAG | [-1460 / -1455] | |
| 3 | Ets | ci0100140048 | AGGAAA | [-1445 / -1440] | |
| 4 | GATA | ci0100131697 | ATATCT | [-1432 / -1427] | |
| 5 | GATA | ci0100131697 | AGATAG | [-1425 / -1420] | |
Sequence
ANISEED Coordinates: [-1541 / -1417]
Length: 124
BASE COUNT 32A 24C 27G 41T
CGTGTGATAGTGCGTGATAACTCGTATCCTTTCGCACTGCGTTCCTATCCGTACTTTGGATCTGAAGCT CGTTATCTCTAACGGAAGTTTTCGAAAAGGAAATTGTTCAATATCTAAGATAGGA
References:
Bertrand V, Hudson C, Caillol D, Popovici C, Lemaire P. Neural tissue in ascidian embryos is induced by FGF9/16/20, acting via a combination of maternal GATA and Ets transcription factors. PUBMED ID: 14651852
Aniseed version 3.0 - Contact: contact@aniseed.cnrs.fr
ANISEED, NISEED Website and Database are under GPL License.
ANISEED, NISEED Website and Database are under GPL License.
© Tassy, Daian, Sobral, Dauga, Khoueiry, Salgado, Lemaire 2007